Superscript ii rnase h reverse transcriptase from invitrogen. Invitrogen was founded in 1987 by lyle turner, joe fernandez, and william mcconnell and was incorporated in 1989. Reverse transcription of sodium borohydridetreated ac4c results in partial incorporation of adenosine in the cdna strand opposite the reduced ac4c. Invitrogen catalog first page, datasheet, datasheet search, data sheet, datasheets, datasheet search site for electronic components and semiconductors, integrated circuits, diodes, triacs, semiconductors. This enzyme is genetically engineered by the introduction of,biological,biology supply,biology supplies. Reverse transcription is performed using superscript iii reverse transcriptase invitrogen using the suppliers instructions except that the reaction is carried out for 1h at 50 to disrupt secondary structures in mrna. It should also be noted that reduced ac4c results in partial termination of reverse transcription at or adjacent to its location, often referred to as rtstops fig. When dealing with lowabundance transcripts, the superscript ii system. Superscript iii reverse transcriptase from invitrogen. The following are supplementary data to this article. The use of suboptimal blood or bone marrow volumes for reverse transcription could result in decreased assay sensitivity, because transcripts at very. Reverse transcriptase is an indispensable enzyme for realtime reverse transcriptase rtpcr, a standard method in molecular diagnostics for detection and quantification of defined rna molecules. This new enzyme has been proven to function in experimentally challenging conditions that many scientists face, such as in the presence of enzyme inhibitors found in reagents, cells, blood.
First strand cdnas were then synthesized using the invitrogen superscript iii reverse transcriptase kit. Invitrogen superscript iii onestep rtpcr system with. Invitrogen 18064071 superscript ii reverse transcriptase 4. Superscript iii onestep rtpcr system with platinum taq dna polymerase catalog numbers 12574018 and 12574026 doc.
Superscript iii onestep rtpcr system with platinum taq. Invitrogen superscript iv rt, the most recently introduced enzyme, was engineered to offer superior cdna synthesis performance with even the most challenging rna samples. Superscript iii reverse transcriptase thermo fisher scientific. Superscript iii firststrand synthesis system for rtpcr. Superscript iiisuperscript iii reverse transcriptasernase hm mlv rt cdna. The importance of reverse transcription efficiency.
Whnic nf cgtttggtggaccctcagat 40 m whnic nr ccccactgcgttctccatt 40 m whnic np famcaactggcagtaacca bqh1 10 m realtime rtpcr setup procedure place your samples on ice. Invitrogen qubit 4 manuals manuals and user guides for invitrogen qubit 4. Superscript iii firststrand synthesis system from invitrogen. Life technologies corporation andor its affiliates warrant their products as set.
Analysis of onestep and twostep realtime rtpcr using. Protocol for cdna synthesis and qrtpcr cdna synthesis. The amount of starting material can vary from 1 pg5 g of total rna. Pd olson notes uses a reverse transcriptase polymerase enzyme to turn a sample of singlestranded rna into doublestranded copy dna cdna. The system can detect a wide range of rna targets from 300 bp to 10kb, and is compatible with multiplex. The company initially found success with its kits for molecular cloning notably, the librarian, a kit for making cdna libraries, and the fasttrack kit. Specially formulated for realtime applications, it is the ideal onestep system for detection with either lux fluorogenic primers or duallabeled probes. Reagent 100 ml 15596026 200 ml 15596018 dnase i, amplification grade 100 units 18068015 custom primers to order, visit. However after reverse transcription with superscript iv kit invitrogen i got really poor quality in terms of concentration and 260280 values. Invitrogen superscript iii firststrand synthesis system.
Pdf analysis of onestep and twostep realtime rtpcr. Invitrogen superscript iii cellsdirect cdna synthesis. The invitrogen superscript iii firststrand synthesis supermix for qrtpcr provides the hightemperature capability of superscript iii reverse transcriptase in an optimized supermix format for the synthesis of firststrand cdna for use in realtime quantitative rtpcr qrtpcr. We have 1 invitrogen qubit 4 manual available for free pdf download. Using the superscript onestep system the system uses a mixture of superscript iii reverse transcriptase and platinum taq dna polymerase high fidelity for enhanced rtpcr yields and fidelity, as well as the detection of longer templates. Rna was extracted from the cell lines using qiagen rneasy plus mini kit.
Download a pdf containing pricing for our full product list. Superscript iii reverse transcriptase rt is active at 50c and has a halflife of 220 minutes, providing increased specificity with genespecific primers gsps and the highest cdna yield of all rts. Invitrogen manual version d link updated august 2017. Reverse transcription an overview sciencedirect topics. This protocol was kindly developed and provided by. Here is an archived copy of the invitrogen 3insert multisite gateway manual, version d, 30707. Superscript iii reverse transcriptase 2,000 units total, at 200ul is supplied with a vial 1 ml of 5x firststrand buffer 250 mm trishcl ph 8. Third, less manual operation was involved in the screening process, which r5 were purified and cloned using the topo ta cloning kit invitrogen co topo ta cloning kit manual invitrogen. Superscript iii rt 200 ul 10 l 50 l 5x firststrand buffer l l 0. Superscriptz iii onestep rtpcr system with platinum. Sep 01, 2004 for example, for htr2a, the ct was 32. Superscript iiisuperscript iii reverse transcriptasernase hmmlv rtcdna. Detection limits of several commercial reverse transcriptase. Agata smogorzewska and colleagues report mutations in slx4 in a new subtype of fanconi anemia.
The superscript iii firststrand synthesis system introduces rnase h activity only when it is. The invitrogen and roche products are included in cdcs reagent qualification program. Polymerase superscript iii onestep rtpcr system with. Onestep quantitative rtpcr system 100 rxns 11732020 500 rxns 11732088 microtomidi total rna purification system 50 rxns 12183018 trizol. Mutations of the slx4 gene in fanconi anemia nature genetics. Taq dna polymerase is designed for the sensitive, reproducible, endpoint detection and analysis of rna molecules by rtpcr. Slx4 is an endonuclease involved in dna maintenance and repair. Reverse transcription should be carried out with a defined minimum amount of mrna and highefficiency reverse transcriptase, such as moloney murine leukemia virus or superscript invitrogen. We originally had a live link to the invitrogen site, but after this link broke it seemed easier to hardarchive a copy.
The following is a list of ancillary reagents that are not supplied with the cdc denv. Superscript iv reverse transcriptase for rna analysis eshg. The trioplex realtime rtpcr assay trioplex rrtpcr is intended for the qualitative detection and differentiation of rna from zika virus, dengue virus, and chikungunya virus in. Topo ta cloning kit manual invitrogen phychijackmep.
It is a dna polymerase that synthesizes a complementary dna strand from singlestranded rna dna or an rna. Superscript iii reverse transcriptase is a version of mmlv rt that has been engineered to reduce rnase h activity and provide increased thermal stability. Read the safety data sheets sdss and follow the handling instructions. The superscript iii firststrand synthesis system introduces rnase h activity only when it.
The amount of starting material can vary from 1 pg5. Superscript iii platinum onestep quantitative rtpcr system. Superscript iv reverse transcriptase thermo fisher. Jun 06, 2015 superscriptiv is the newest member of the superscript family of reverse transcriptases, which is known for its quality and reliability in cdna synthesis. Additionally, as the halflife of superscript iii is 220 minutes at 50. The superscript iii enzyme used with this kit is a version of mmlv reverse transcriptase that has reduced rnaseh activity, a longer halflife 220 minutes and is more thermostable, resulting in increased specificity and higher yields. Rna targets from 100 bp to 12 kb can be detected with this system. Selection, characterization and application of nucleic. In summary, invitrogens superscript iii is the best rt, of the three i have used. Invitrogen superscript iii cellsdirect cdna synthesis kit. Protoscript ii first strand cdna synthesis kit features two optimized mixes, protoscript ii enzyme mix and protoscript ii reaction mix. Place invitrogen 2x pcr master mix and superscript iii rtplatinum taq enzyme mix in a cold rack at 28c. The enzyme mix combines protoscript ii reverse transcriptase and murine rnase inhibitor, while the reaction mix contains dntps and an optimized buffer. The invitrogen superscript line of reverse transcriptases rts represents the most widely used and highly referenced rts for cdna synthesis in many applications.
For htr2b, the difference in yield with the two enzymes was only 2 25. The superscript iii cellsdirect cdna synthesis kit is optimized for synthesizing firststrand cdna directly from a mammalian cell lysate without first isolating the rna. Superscript iii platinum twostep qrtpcr kit for lux and probe based detection systems superscript iii platinum twostep qrtpcr kit with sybr green for detection based on sybr green kit components. The enzyme is used to synthesize cdna at a temperature range of 42 to 55c, providing increased specificity, higher yields of cdna, and more fulllength product than other reverse. Invitrogen superscript iii platinum onestep qrtpcr system ref. Protoscript ii first strand cdna synthesis kit neb. C, cdna yields are far superior to that obtained with superscript ii and other rts as claimed by invitrogen.
Invitrogen superscript iii reverse transcriptase is a genetically engineered mmlv reverse transcriptase rt that was created by introduction of several mutations for reduced rnase h activity, increased halflife, and improved thermal stability. The company initially found success with its kits for molecular cloning notably, the librarian, a kit for making cdna libraries, and the fasttrack kit for mrna isolation from biological samples. Description the superscriptz iii onestep rtpcr system with platinum. Superscript ii rnase h reverse transcriptase from invitrogen,superscript ii rnase h reverse transcriptase rt is an improved version of the superscript rnase h rt. To quantify cellfree hiv1 by qrtpcr, we extracted rna from 25 to 50. An aptamersirna chimera suppresses hiv1 viral loads and. Quantification of mrna using realtime rtpcr nature. Of the reverse transcriptase enzymes screened by our lab tgirtiii rt ingex. Lightcycler 480 96 adjustments may be required for the use of other kits or other realtime pcr instruments. Invitrogen superscript iii reverse transcriptase fisher. If you have less than 1 g rna, you can consider to reduce the volume to half and the enzyme to match the amount of rna.
Comparison of reverse transcriptases in gene expression. Superscript iii rt offers higher cdna yields, improved. In summary, both superscript iii onestep and twostep methods yield reaction. Lysis and reverse transcription are performed in the same tube, and the resulting firststrand cdna is ready to use in cloning and pcr. Invitrogen superscript iii reverse transcriptase is a genetically engineered mmlv reverse transcriptase rt that was created by introduction of several.
Generacer kit with superscript iii rt and topo ta cloning. Invitrogen superscript iii firststrand synthesis system 50. For twotube procedure, use a thermostable reverse transcriptase e. Generacer kit with superscript iii rt and topo ta cloning kit for the advanced protocol starts at the rna level by specifically targeting only 5. Superscript iv reverse transcriptase for rna analysis.
973 295 1518 200 449 799 352 949 1333 699 851 690 798 809 968 1259 875 3 137 935 1472 1090 220 1629 26 640 607 1163 186 1285 1157 1024 840 662 456 323 356 1347 788 346 711